Id Trinity | FTRINITY_DN46982_c0_g2_i1 |
---|---|
Name Transcript | Ll_transcript_40559 |
Sequence | CACAGTTTGGGTTGCAGCAAACAAAGAAAAGTGTCATTCCTTCTTCCCCTCTGGCAGTTGCCTGGAAGAAGACAGCCTCTCCATGATTACATTGAGTACA GCGAACAGCCTTGGTGCGAGGAAGTGTTGGATCGGCAGCTACATCCTGCAACACCTGAGTTCGCTCTCCAACTGAGTGATGTATCTCGTTTCTATAGACA CAGTTGTTATCAGCAACCTCCTGGTG BLAST |
Tissue | flowers |
Gene name | LI_gene_15273; |
Additional information | - |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_40559
Blastp | - |
---|---|
Blastx | DNA-directed RNA polymerases II, IV and V subunit 9B from Arabidopsis with 86.67% of identity |
Eggnog | DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates (By similarity)(COG1594) |
Kegg | Link to kegg annotations (AT4G16265) |
CantataDB | Link to cantataDB annotations (CNT0002206) |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019418809.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |