| Id Trinity | FTRINITY_DN47200_c0_g2_i1 |
|---|---|
| Name Transcript | Ll_transcript_116148 |
| Sequence | CTTGCTTCCTAGAGCTTTTGCCATTTGTCCAATAATGGTTAATGCAAGGTTTTTCAGTTCTTCTAAATAAAGTTCTAGAGTGTCTCTCAAAGGAAGTGGA AAGTTAGGGAATAAGTGAGGTTTCCTCATATGAATTGGACGTGTGAACAATATCAAAATATCAGACCAATCAAGTTTTTGGTTCTCAGAAACAACAAAAG TTTGTCCAAACCCTTCAAAATCTTCACAACTTTGCCAAAACCTCTTCTTCTCTGACATAGGAAGGTTGAACAAATCTTTAATCTCTAACTTAACCTTATC CAATAAGCTTGACTCAACTCCA BLAST |
| Tissue | flowers |
| Gene name | LI_gene_15530; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_116148
| Blastp | Protein SRG1 from Arabidopsis with 59.62% of identity |
|---|---|
| Blastx | Protein SRG1 from Arabidopsis with 59.62% of identity |
| Eggnog | 2OGFe(II) oxygenase(COG3491) |
| Kegg | Link to kegg annotations (AT1G17020) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019424937.1) |
| Pfam | non-haem dioxygenase in morphine synthesis N-terminal (PF14226.5) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |