Id Trinity | FTRINITY_DN47200_c0_g2_i1 |
---|---|
Name Transcript | Ll_transcript_116148 |
Sequence | CTTGCTTCCTAGAGCTTTTGCCATTTGTCCAATAATGGTTAATGCAAGGTTTTTCAGTTCTTCTAAATAAAGTTCTAGAGTGTCTCTCAAAGGAAGTGGA AAGTTAGGGAATAAGTGAGGTTTCCTCATATGAATTGGACGTGTGAACAATATCAAAATATCAGACCAATCAAGTTTTTGGTTCTCAGAAACAACAAAAG TTTGTCCAAACCCTTCAAAATCTTCACAACTTTGCCAAAACCTCTTCTTCTCTGACATAGGAAGGTTGAACAAATCTTTAATCTCTAACTTAACCTTATC CAATAAGCTTGACTCAACTCCA BLAST |
Tissue | flowers |
Gene name | LI_gene_15530; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_116148
Blastp | Protein SRG1 from Arabidopsis with 59.62% of identity |
---|---|
Blastx | Protein SRG1 from Arabidopsis with 59.62% of identity |
Eggnog | 2OGFe(II) oxygenase(COG3491) |
Kegg | Link to kegg annotations (AT1G17020) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019424937.1) |
Pfam | non-haem dioxygenase in morphine synthesis N-terminal (PF14226.5) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |