| Id Trinity | FTRINITY_DN48688_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_104157 |
| Sequence | CTGATTAGAGAGGTTATCTAGAATTGAATTCGTTTTACGTGTTAATATATATTTGATTGGTTAAACTATTTTGGTTTTAGTGCAAACAATATTACTGTGA TATAAACGTTTCTTTATAAGTTGAGGTGCATTTCAGAAAAATTCAGTGTCAAGGAGAATCTAGGTAATATTTTGCGACAATCCACGGGCCCTTTAGCAAA AATGGACATTTCCCAAACTCTAAACCGCAACATATGGGAATCCGACCCGGAATTATTCGAAATAATGAAAAAAGAGAAACTTAGACAAAAATCTGGGCTT GAAATGATCGCTAGTGAAAATTTCACGACCCTGCCCGTCTTGCAGTGCCTTAGTTCCTGCCTGCACAACAAATATTCTGAAGGCCTCCCCGGGCAGAGGT ATTACGGTGGTAACGAATTTATTGACCAAGTCGAACTGCTAGCGCAAAAAAGATCGCTGG BLAST |
| Tissue | flowers |
| Gene name | LI_gene_17411; |
| Additional information | - |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_104157
| Blastp | - |
|---|---|
| Blastx | Serine hydroxymethyltransferase from Caenorhabditis with 59.41% of identity |
| Eggnog | Catalyzes the reversible interconversion of serine and glycine with tetrahydrofolate (THF) serving as the one-carbon carrier. This reaction serves as the major source of one-carbon groups required for the biosynthesis of purines, thymidylate, methionine, and other important biomolecules. Also exhibits THF- independent aldolase activity toward beta-hydroxyamino acids, producing glycine and aldehydes, via a retro-aldol mechanism (By similarity)(COG0112) |
| Kegg | Link to kegg annotations (CELE_C05D11.11) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_015960843.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |