Id Trinity | FTRINITY_DN48688_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_104157 |
Sequence | CTGATTAGAGAGGTTATCTAGAATTGAATTCGTTTTACGTGTTAATATATATTTGATTGGTTAAACTATTTTGGTTTTAGTGCAAACAATATTACTGTGA TATAAACGTTTCTTTATAAGTTGAGGTGCATTTCAGAAAAATTCAGTGTCAAGGAGAATCTAGGTAATATTTTGCGACAATCCACGGGCCCTTTAGCAAA AATGGACATTTCCCAAACTCTAAACCGCAACATATGGGAATCCGACCCGGAATTATTCGAAATAATGAAAAAAGAGAAACTTAGACAAAAATCTGGGCTT GAAATGATCGCTAGTGAAAATTTCACGACCCTGCCCGTCTTGCAGTGCCTTAGTTCCTGCCTGCACAACAAATATTCTGAAGGCCTCCCCGGGCAGAGGT ATTACGGTGGTAACGAATTTATTGACCAAGTCGAACTGCTAGCGCAAAAAAGATCGCTGG BLAST |
Tissue | flowers |
Gene name | LI_gene_17411; |
Additional information | - |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_104157
Blastp | - |
---|---|
Blastx | Serine hydroxymethyltransferase from Caenorhabditis with 59.41% of identity |
Eggnog | Catalyzes the reversible interconversion of serine and glycine with tetrahydrofolate (THF) serving as the one-carbon carrier. This reaction serves as the major source of one-carbon groups required for the biosynthesis of purines, thymidylate, methionine, and other important biomolecules. Also exhibits THF- independent aldolase activity toward beta-hydroxyamino acids, producing glycine and aldehydes, via a retro-aldol mechanism (By similarity)(COG0112) |
Kegg | Link to kegg annotations (CELE_C05D11.11) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_015960843.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |