Id Trinity | FTRINITY_DN49180_c1_g1_i1 |
---|---|
Name Transcript | Ll_transcript_12777 |
Sequence | CTTTCATCCTTTGTCTGTACAGAAGGCTTACCAAGGCCATCCTCTTTCTCTGGTGTATCAGGTTTTGGAGGTGTACATGCCTGAGATACAATTCTAAGGC ATGGAAGAATGACATACTCAGATATAGCAGGATGCTTTGCACCCAACTTAATAGAAGAAAACAACAACTGAAATACAATGCGTAGCCTTGACTCCCAGAA TTCATCAGCCAAAGAACACACCTCAGAAAGTAA BLAST |
Tissue | flowers |
Gene name | LI_gene_18146; |
Additional information | - |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_12777
Blastp | - |
---|---|
Blastx | Auxin transport protein BIG from Arabidopsis with 81.01% of identity |
Eggnog | Ubiquitin protein ligase E3 component n-recognin 4(ENOG410XPP8) |
Kegg | Link to kegg annotations (AT3G02260) |
CantataDB | Link to cantataDB annotations (CNT0002836) |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019452981.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |