Id Trinity | FTRINITY_DN49837_c0_g1_i6 |
---|---|
Name Transcript | Ll_transcript_82005 |
Sequence | TTTTCTGCACAGCGCTCTACAGTATGTACTGAATCTCCACCTTTCTTAATTCCCGTTCCTATAGATTCTTGTTATATTGGTTCTAACAATTCTGCGTTCC TCCAGCAGGCTTCATACATAACTGGTGGCATATATTACAAGCCTCCCCAATTGGACGGGCTTTTTCAATATCTTTCAACGGTGTTTGCAACTGATTTGCA TTCTCGTGCTTTTTTACGGCTCCCTAAATCTCTGGGTGTGGATTTTCGTGCCTCGTGCTTTTGCCATAAGCAAACAATTGACATGGGCTATGTATGTTCT GTATGCTTATCCATATTCTGTGAGCGTCATGATAAGTGTTCAACTTGCGGGTAAGTGTTTATTTCTCTTCAACATTATATCATGATGATTCATTATCCTG TTTCCGTTACCTTCTCACACATGATGCC BLAST |
Tissue | flowers |
Gene name | LI_gene_19141; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_82005
Blastp | RNA polymerase II transcription factor B subunit 4 from Arabidopsis with 73.5% of identity |
---|---|
Blastx | RNA polymerase II transcription factor B subunit 4 from Arabidopsis with 73.33% of identity |
Eggnog | Transcription factor(COG5242) |
Kegg | Link to kegg annotations (AT1G18340) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019438573.1) |
Pfam | Transcription factor Tfb4 (PF03850.13) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |