Id Trinity | FTRINITY_DN51894_c0_g2_i3 |
---|---|
Name Transcript | Ll_transcript_186779 |
Sequence | TTGTGGAGGAATGTGAGAAGAGGTGGTATCTGTTCTCTAATCCTTCATCTTGTTTTGCGTTCTTATTTCTGATTTTCCATGTGGTTATTTTTTGCATTCA GGAATCGCCTTCGCTTGCTCACACAATTCTTGGAACATCTAGTATCTGAGGGAAGCCAGGATGTACATGTTCACAATGCACTGGGTAAAATCATCATTGA TAGCAACAACAACTCAGAGCATTTTCTCACTACCAACCCATACTATGATTCTCGAGTTGTGGGCAAATATTGTGAGAAACGTGATCCGACCTTGGCAGTT GTAGCTTATAGGCGAGGGCAATGTGATGATGAACTTATCAATGTCACAAACAAAAATTCTTTGTTCAAACTACAAGCAAGATATGTTGTCGAG BLAST |
Tissue | flowers |
Gene name | LI_gene_23172; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_186779
Blastp | Clathrin heavy chain 2 from Oryza sativa with 97.96% of identity |
---|---|
Blastx | Clathrin heavy chain 2 from Oryza sativa with 97.8% of identity |
Eggnog | clathrin heavy chain(ENOG410XPH1) |
Kegg | Link to kegg annotations (4351255) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019414955.1) |
Pfam | Region in Clathrin and VPS (PF00637.19) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |