Id Trinity | FTRINITY_DN52083_c0_g2_i1 |
---|---|
Name Transcript | Ll_transcript_221004 |
Sequence | GTCGGCGAGTCGCGATGTCTCACCGTAAATTCAGTGCACCCCGCCATGGGTCCATGGGCTTCTACCCCAAGAAGCGTGCGGCCCGTCACCGTGGTAAGGT TAAGGCCTTCCCACAGGATGACCCTTCCAAGCCTGTCCACCTTACTGCCTTCGTCGGCTACAAGGCTGGCATGACACACGTCGTACGAGAGGCTGATCGG CCTGGGTCAAAATTAAACAAGAAAGAGATTGTAGAGGCTGTAACCATCCTTGAAACTCCCCCGATGGTGGTTGTTGGTGTTGTTGGATACATTGTTACCC CCTATGGTATGCGTGCCCTCAAGACGGTGTGGGCTGAACACCTTTCTGAAGATTGCCGCCGTAGATTCTACAAGAACTGCTCTCCACTCGGTTTTCCGAT GAGAGATAAGCTCGCC BLAST |
Tissue | flowers |
Gene name | LI_gene_23725; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_221004
Blastp | 60S ribosomal protein L3 from Sophophora with 84.3% of identity |
---|---|
Blastx | 60S ribosomal protein L3 from Sophophora with 84.3% of identity |
Eggnog | One of the primary rRNA binding proteins, it binds directly near the 3'-end of the 23S rRNA, where it nucleates assembly of the 50S subunit (By similarity)(COG0087) |
Kegg | Link to kegg annotations (Dmel_CG4863) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_013457261.1) |
Pfam | Ribosomal protein L3 (PF00297.21) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |