| Id Trinity | FTRINITY_DN52211_c0_g1_i2 |
|---|---|
| Name Transcript | Ll_transcript_28959 |
| Sequence | GAGAAAGAGAGAGAGAGAGAACGAAAATGAGCGGAACAGTGAAGAAAGTGAGCGATATCGCATTCAAAGCTGGTAAAACCATCGATTGGGATGGAATGGC GAAACTTCTCGTCTCCGATGAAGCTCGCAAGGAATTCTCCAATCTCCGTCGCGCTTTTGATGAGGTTAACTCTCAACTCCAAACCAAATTCAATCAGGAG CCTGAGCCCATAGACTGGGATTATTATAGAAAAGGAATTGGAAATCGTTTGGTGGATATGTACAAGGAGCACTATGACAGCATAGAGGTCCCTAAGTTTG TTGACAATGTTACTCCTCAATATAAGCCTAAATTTGAAGCACTATTAGTTGAGCTTAAGGAAGCGGAGCAGAAATCTTTTAAGGAATCTGAGCGTTTGGA AAAGGAAATTGC BLAST |
| Tissue | flowers |
| Gene name | LI_gene_24238; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_28959
| Blastp | ATP synthase subunit d, mitochondrial from Arabidopsis with 82.03% of identity |
|---|---|
| Blastx | ATP synthase subunit d, mitochondrial from Arabidopsis with 82.03% of identity |
| Eggnog | energy coupled proton transport, down electrochemical gradient(ENOG4111IHJ) |
| Kegg | Link to kegg annotations (AT3G52300) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019427572.1) |
| Pfam | ATP synthase D chain, mitochondrial (ATP5H) (PF05873.11) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |