| Id Trinity | FTRINITY_DN52496_c0_g6_i2 |
|---|---|
| Name Transcript | Ll_transcript_88238 |
| Sequence | CCGCAGTTGCCACATCCCAGGATTCCCTTTCTCTCTTCTCTCTCACTTTTTCTTCTCGCCAGCAGGAACAGTGAATCCCATTTTCTCAATTCAGTCCTCT CTTTTTCAAGTTCTGCGATTGCATTGTGTGTAAGAGAAGATGGAAAGTAAAAGTGGTTATCATAGAAGGAGTTTTTCGTCTGGGAAGAGATTTTCTGAGT CTGGAGTGCCTCACTCTACTGCTCGAAAATCTTATTCGTCTTTGCGCTCCCTTGTGCGATTAACGGGAGAGCGAACAGTGAAATCATTGCGACTTTCAAA GGCCTTGACAGTACCTGACACAACATCTGTCTATGAAGCTTGTCGTCGGATGGCTGCCCGTAGAGTAGATGCTGTATTGCTAACTGATACTAATGCCATG ATCTGTGGAATCCTTACAGACATGGACATAGTAACAAGAGTTATTGCTAAAGATATTAATCTTCAAGACACATCTGTTTCCAAGGTTATGACTAAGAATC CAACATTTGTCCTTTCTGAAAGTCTTGCTGT BLAST |
| Tissue | flowers |
| Gene name | LI_gene_25949; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_88238
| Blastp | CBS domain-containing protein CBSCBSPB1 from Arabidopsis with 59.85% of identity |
|---|---|
| Blastx | CBS domain-containing protein CBSCBSPB1 from Arabidopsis with 59.85% of identity |
| Eggnog | Catalyzes the conversion of inosine 5'-phosphate (IMP) to xanthosine 5'-phosphate (XMP), the first committed and rate- limiting step in the de novo synthesis of guanine nucleotides, and therefore plays an important role in the regulation of cell growth (By similarity)(COG0517) |
| Kegg | Link to kegg annotations (AT5G63490) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019419084.1) |
| Pfam | CBS domain (PF00571.27) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |