Id Trinity | FTRINITY_DN52581_c3_g4_i4 |
---|---|
Name Transcript | Ll_transcript_252450 |
Sequence | CTATGGACAACTTGATATCATGTTCAACAATGCTGGGGTTCTTGGAAATCAATCAAAGAATAAAAGCATAGTAAACTTTGACCCTATTGAGTTTGATAAA GTGATGAGTGTGAATGTGAAGGGTATGGCTTTAGGGATCAAGCATGCAGCAAGGGTTATGATTCCTAGAGGAGTTGGGTCAATTATATCAACATCAAGTG TAGCTGGTGTTATGGGAGGGCTTGGTCCTCATGCTTATACAGCTTCTAAGCATGCCATTGTTTGGATTACAAAGAACACAGCTTGTGAGTTGGGAAGGTA TGGAATAAGAGTCAATTGCATTTCTCC BLAST |
Tissue | flowers |
Gene name | LI_gene_26617; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_252450
Blastp | Short-chain dehydrogenase reductase 2a from Arabidopsis with 75.23% of identity |
---|---|
Blastx | Short-chain dehydrogenase reductase 2a from Arabidopsis with 75.23% of identity |
Eggnog | Dehydrogenase reductase(COG1028) |
Kegg | Link to kegg annotations (AT3G51680) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019465209.1) |
Pfam | Enoyl-(Acyl carrier protein) reductase (PF13561.5) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |