Id Trinity | FTRINITY_DN52646_c3_g1_i2 |
---|---|
Name Transcript | Ll_transcript_208061 |
Sequence | TCTCTCTCTCTCTCTCTCTCTCTCTCTGCATTCAACATGGTACGTTTTTATACTCAGTTTTTGTCCATTCACATGTGCGTGTGTTATTTGAAATTTTTGA GCTTTTTGTTTTAGTGATAATCAAAATGCAAACTTTAGTAGATTTTTGTAACTTGTGATTTGAAATCAACAATTTTGAAACCGACCCTCGTCTTGTTTAT GGTGAATATTGTTAATGATAGTGATTATTGTTATTTTGGTGATTGGGGGTTTATAGTCTCTGGTAGCAAACGAGGATTTTCAGCACATACTTCGTGTTCT GAACACAAATGTAGATGGGAAGCAGAAGATTGT BLAST |
Tissue | flowers |
Gene name | LI_gene_27133; |
Additional information | - |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_208061
Blastp | - |
---|---|
Blastx | 40S ribosomal protein S18 from Arabidopsis with 95.45% of identity |
Eggnog | Located at the top of the head of the 30S subunit, it contacts several helices of the 16S rRNA. In the 70S ribosome it contacts the 23S rRNA (bridge B1a) and protein L5 of the 50S subunit (bridge B1b), connecting the 2 subunits(COG0099) |
Kegg | Link to kegg annotations (AT1G22780) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (NP_001236608.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |