Id Trinity | FTRINITY_DN52651_c4_g1_i1 |
---|---|
Name Transcript | Ll_transcript_207406 |
Sequence | ATGGAGGTCTGGAATATTTAGTCTTCCTCTAAGTAAACATTAGGGACAAGATTTGTATGAATTAGAAAGCTCTCTGTTTTATTTCTTATGGCCGTGCTCT GTTTGTAATCCCTATTAAAATTGGCTTTGTAGGTATGACTCTAGGAATTCGGTTTTAGAGTGGTCTGTTCTTCTTATTGATAACTCAAACCGCAGTGGGT CAATGGAGTTTGTCGTTCCACAAGCAGATTCATCAGCATTCTTTCCCATCTCAGTTCGTTTTATGGCAATTGAGACATTCAGTGACCTGAAGGTTACTAA CATCATACCACTAAAGGGTGGTAATCCTCCCAAGTTTTCTCAGAGGACACAGTTGATCACAGAAAACTATCAAGTTATTTGATTGATTTTTCTCTCGTCT CTTAGCTCCTAAGACAGTTTTGCTATTACAGTCGTGCCTCCTTTATCAAAAGGCTTTTGCTTCCCCAAGTTATATAATTTGTTACTATTCATGAATTTTT GTTGTTAGTGGCCTTGAATTTATGCGTTAGTTTTACTTTGCTATACTTGGTGGAAAATATGATTCATCATAATTAATGACAGTTTGGTTGATGTTTGCAT ATTTTCTAGAGATACGATTGTTTATTTTTAAAAGGTCCATTTTCCATAGTTGTTTATAAAGCTGTTTTGAACATAAGATAAGTTAATCTAAAA BLAST |
Tissue | flowers |
Gene name | LI_gene_27182; |
Additional information | - |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_207406
Blastp | - |
---|---|
Blastx | Coatomer subunit delta-2 from Oryza sativa with 78.05% of identity |
Eggnog | The coatomer is a cytosolic protein complex that binds to dilysine motifs and reversibly associates with Golgi non- clathrin-coated vesicles, which further mediate biosynthetic protein transport from the ER, via the Golgi up to the trans Golgi network. Coatomer complex is required for budding from Golgi membranes, and is essential for the retrograde Golgi-to-ER transport of dilysine-tagged proteins(ENOG410XRH2) |
Kegg | Link to kegg annotations (4338376) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019427675.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |