Id Trinity | FTRINITY_DN52667_c0_g1_i14 |
---|---|
Name Transcript | Ll_transcript_209136 |
Sequence | AGAACTAAGAGAAAATCTATGCTTTCTGCTCTTGAAAAGGTCAAAGAAGAAAAGAATTCTGGAACAGTGGAACACATTTTCTGGCCTAGTTCAGAATATT CAAATAGAACAATTCTCCAAGAGAATGTGAACAATGGTCTGCATAATTATTGTCCTAAGGGTAAGGAATCATTCGCCTCTTATGAAAGCCTTGAGCAGCT TCATTCGTTACTGTTCATCCTCGGCGTCACTCATGTTTTCTATAGCTTTATTGCTGTTGGCTTGGCCATGATCAAGGTTAAAATAGGCATGATCAAACTT TCCTCATACTCCAATTTTGGTGACACTAAT BLAST |
Tissue | flowers |
Gene name | LI_gene_27286; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_209136
Blastp | MLO-like protein 11 from Arabidopsis with 34.07% of identity |
---|---|
Blastx | MLO-like protein 11 from Arabidopsis with 34.07% of identity |
Eggnog | May be involved in modulation of pathogen defense and leaf cell death (By similarity)(ENOG410XR5S) |
Kegg | Link to kegg annotations (AT5G53760) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019444838.1) |
Pfam | Mlo family (PF03094.14) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |