Id Trinity | FTRINITY_DN52698_c1_g1_i7 |
---|---|
Name Transcript | Ll_transcript_207390 |
Sequence | GAAGGTAGATGCTCGTCGTCACGGAGGCGTGGCTCGATGAGGCCGCCGAGCATGGACGCCGATGAGTTCATGAACCTGTTGCACGGTTCGGATCCGGTGA AGGTTGAGCTCAATCGGCTTGAGAATGAAGTTCGAGATAAGGATAGAGAGTTATCAGAAGCGCAAGCTGAAATCAAAGCCTTGAGACTCTCTGAGAGACT TAGAGAAAAAGCAGTAGAAGAGCTTACTGAAATACTGTCAAAGGTTGAAGGGAAGCTAAAATTAACGGAGTCCCTTCTAGAAAGCAAAAATCTTGAAATA AAGAAAATAAACGATGAAAAGAAGGCATCAATGGCAGCTCAGTTTGCAGCTGAAGCCACTCTTCG BLAST |
Tissue | flowers |
Gene name | LI_gene_27491; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_207390
Blastp | Microtubule-associated protein 70-4 from Arabidopsis with 81.15% of identity |
---|---|
Blastx | Microtubule-associated protein 70-4 from Arabidopsis with 86.54% of identity |
Eggnog | microtubule-associated proteins 70-4(ENOG41104MM) |
Kegg | Link to kegg annotations (AT1G14840) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019420322.1) |
Pfam | Microtubule-associated protein 70 (PF07058.10) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |