Id Trinity | FTRINITY_DN52826_c0_g1_i6 |
---|---|
Name Transcript | Ll_transcript_233951 |
Sequence | GGGTTCGAAAACCCTAATGGATTGTTGTGAACCACCTTCCAAGCGATTCAAACAAACTCTCTCTCCCTCAACCTCCGAATCCAATGCACTAGAGGAGTTG ATGGTGGAAGAGACATGGTTGGAAGCTCTAAATGGAGAATTACAAAAACCTTATGCCCTTACTCTTTCCAAATTCGTCCAATCTCAGATTTCTAGCGCCA ACGATGTCTATCCTCCAACTCATTTGATTTTCAATGCTCTTAATTCTACTCCCTTAAGTACACTTAAGGTTGTTATCCTTGGCCAGGACCCTTATCATGG ACCTGGTCAAGCAATGGGCCTCTCATTCTCTGTGCCTGAGGGAGTCAAAGTTCCTTCCAGTTTGGCAAATATATTTAAGGAACTACGGAAAGACCTTGGC TGTTCAATTCCCCCCCATGGAAATCTACAAAAATGGGCTGTGCAGGTGAGCATTGCAATCGGAACAACTGCG BLAST |
Tissue | flowers |
Gene name | LI_gene_28407; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_233951
Blastp | Uracil-DNA glycosylase, mitochondrial from Arabidopsis with 64.96% of identity |
---|---|
Blastx | Uracil-DNA glycosylase, mitochondrial from Arabidopsis with 64.96% of identity |
Eggnog | Excises uracil residues from the DNA which can arise as a result of misincorporation of dUMP residues by DNA polymerase or due to deamination of cytosine (By similarity)(COG0692) |
Kegg | Link to kegg annotations (AT3G18630) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019413536.1) |
Pfam | Uracil DNA glycosylase superfamily (PF03167.18) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |