Id Trinity | FTRINITY_DN52837_c0_g2_i1 |
---|---|
Name Transcript | Ll_transcript_235306 |
Sequence | GAACATTATTTTCCACACACGCTCTCTCTCTTTCTTATTTTCTTCCTTTTCTTGTTTTCTTTATCTTCATTCTTCTCTGTCACAGATCTTGACTTGAGTT GTTTACAGACTAGAGTTGATAGCACCATAATCCACATATTCATTTTGCACCAACAAAAAAAAATGGGCATCTTTTTTATACCCAAAGCAACTTCATGCAT TTTGTTCTTGTTTCTTATGTCTTGTACTTGCTTCATTTCAACAGATGCTTATGATCCACTTGACCCAAATGGAAATATCACAATCAAATGGGATATTATA AGCTGGACACCTG BLAST |
Tissue | flowers |
Gene name | LI_gene_28495; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_235306
Blastp | COBRA-like protein 5 from Oryza sativa with 64.1% of identity |
---|---|
Blastx | COBRA-like protein 5 from Oryza sativa with 64.1% of identity |
Eggnog | cobra-like protein(ENOG410YAAC) |
Kegg | Link to kegg annotations (4333114) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019456436.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |