Id Trinity | FTRINITY_DN52850_c5_g1_i2 |
---|---|
Name Transcript | Ll_transcript_235499 |
Sequence | GGAAAAGATTTATGCATATTTTCTAGTGATCAGATAAAACATTTCATTCAAAGCCTCTCAATTTTTGTTCATTGTCTTTTTGTCACACATAAAGATTACC AACCTAAGACACAACCACACAGAGAAAATAGTCATCATGGCTAGCTGCAACATAGCATCAGTTGCATCTGGATTTCTGTTGTCTCCTAATGTTGCAACAA ACTCACCATCTTCCAGGAACAACACTATGGTTATGTTCCCAACAAAGAACAATGTTTCTTCTTCTTCTTCCTTTTCTAGGCTTGTTGTAAGGGCAGAAGA TGATGCTGCTTCTGCTTCTGCACCTTCAACTGTTACTACTCCAGTAGAAGGTGAAGTAGCTAAAAAACCAAAGCCACCACCAATTGGTCCTAAGAGAGGT GCTAAGGTGAAGATTCTTAGGAGGGAATCCTATTGGTACAAAGAAACTGGTTCAGTTGTTGCTGTTGAGCAGGA BLAST |
Tissue | flowers |
Gene name | LI_gene_28568; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_235499
Blastp | Photosystem I reaction center subunit IV A, chloroplastic from Nicotiana with 55.75% of identity |
---|---|
Blastx | Photosystem I reaction center subunit IV A, chloroplastic from Nicotiana with 55.75% of identity |
Eggnog | - |
Kegg | - |
CantataDB | Link to cantataDB annotations (CNT0000800) |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019429588.1) |
Pfam | Photosystem I reaction centre subunit IV / PsaE (PF02427.16) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |