Id Trinity | FTRINITY_DN52858_c6_g2_i6 |
---|---|
Name Transcript | Ll_transcript_234491 |
Sequence | CTCATGGCTTCTTCCCAAATCCTTCTTCAGAGGTTTGTGATACCACAAAATCCGATTTCGAAAGTGGGTTTTGTTTCTTGTTGTCCCACCTCTCGTCTGG GTTATGGTAACACCCCCTTCACTTCAATTTCATGGAGTCACAGTATTCAGAAACATAGGGCTGGTTTTGTTGTGAGAGCTGAGTCTGAACCCCAAGAAAA TGCCCAAAATGTAGAGCAAGAAGCGCCTCCGATTGATGTTGAAGAAGAACAAGAAAAAGAAAAGGAAGTTTCAGAATCCAAGCCTGCGAGAAAACCTCGA GTGAAGCTTGGAGATATCATGGGGGTAGTTTTGTCATCCCATTTTCTTGCCTCACCTTGTATCTTACTATTACTATTGACATCAATACTGCATAAAAGGG CAATTGA BLAST |
Tissue | flowers |
Gene name | LI_gene_28660; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_234491
Blastp | 50S ribosomal protein L19-1, chloroplastic from Arabidopsis with 34.23% of identity |
---|---|
Blastx | - |
Eggnog | This protein is located at the 30S-50S ribosomal subunit interface and may play a role in the structure and function of the aminoacyl-tRNA binding site (By similarity)(COG0335) |
Kegg | Link to kegg annotations (AT4G17560) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019445029.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |