Id Trinity | FTRINITY_DN52958_c0_g2_i9 |
---|---|
Name Transcript | Ll_transcript_104924 |
Sequence | CTTGAAGATCTGTTTAACTTTTGTAACAGAAAGCTCTCACTAAAAACAGTTCTCATGCTAGCTGATCAAATGATCAATCGTGTTGAGTTTGTTCACTCTA AATCGTTTCTTCATCGAGATATCAAACCAGATAATTTCCTCATGGGCTTGGGAAGGCGGGCTAACCAGGTTTACTGTATTGACTTTGGTTTGGCGAAGAA ATACAGAGATAGTTCAACCCATCAACACATTCCATACAGGGAGAATAAGAATTTGACTGGAACTGCAAGATATGCTAGCACGAATACTCATCTTGGCATT GAGCAAAGTCGAAGAGATGATCTAGAGTCTCTTGGTTATGTCTTGATGTACTTCCTGAGGGGAAGTCTCCCTTGGC BLAST |
Tissue | flowers |
Gene name | LI_gene_29485; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_104924
Blastp | Casein kinase 1-like protein 1 from Arabidopsis with 92.8% of identity |
---|---|
Blastx | Casein kinase 1-like protein 1 from Arabidopsis with 92.8% of identity |
Eggnog | Casein Kinase(ENOG410XPGP) |
Kegg | Link to kegg annotations (AT4G26100) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019415528.1) |
Pfam | Protein kinase domain (PF00069.24) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |