Id Trinity | FTRINITY_DN53051_c0_g3_i2 |
---|---|
Name Transcript | Ll_transcript_242478 |
Sequence | TGATTGGACTGAATGCCCCTTTGTTCATCCGTGTGAAAATGCAAGGCGACGAGATCCTGTGAAATATCAATACAGTTGTGTCCCTTGCCCTGAATTCCGG AAGGGATTGTGCAGCAAAGGGGATGCTTGTGAGTATGCTCATGGTATTTTTGAGTGTTGGCTTCACCCTGCACAGTATCGAACACGGCTTTGCAAGGATG AGAGTGGATGCACCAGAAGAGTTTGCTTTTTTGCTCACAAGCTGGAGGAACTTCGCCCATTGTATGCATCTACTGGTTCTGCATTGCCTTCTCCTCAATC ATATCCAGCTAGTGCA BLAST |
Tissue | flowers |
Gene name | LI_gene_30344; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_242478
Blastp | Zinc finger CCCH domain-containing protein 66 from Arabidopsis with 85.86% of identity |
---|---|
Blastx | Zinc finger CCCH domain-containing protein 66 from Arabidopsis with 85.86% of identity |
Eggnog | zinc finger CCCH domain-containing protein(ENOG410XR0Z) |
Kegg | Link to kegg annotations (AT5G58620) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019447011.1) |
Pfam | RNA-binding, Nab2-type zinc finger (PF14608.5) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |