Id Trinity | FTRINITY_DN53071_c3_g3_i6 |
---|---|
Name Transcript | Ll_transcript_242149 |
Sequence | GTTCCCCTTTTCTTTCTCTTCACTCAAAAAAATCACTTTTTTCATCATGACAAGAAAAAAAAGTACTTTTTTACAAAAAAAATTGTATTTTTATGTTTGG GTGAGAACAGGTACTGTGTGTCAATATCTGGGTTGGTGGAAAATCCCAAAGAGCTTTTTATGAAAGATATAAGGGCGCTTCCAAAGTATAATGTCACTGC TACACTACAGGTTGGTTATATCACATACAAATCCATAATAAAATGTGTCCTTTTTTCTAAACTTGCATTCAAGTTTTTAAACGGTCCGGTTACCAACGGA TGTTCTTCAAGTGGTACATGCTTGATTCCCCATAAGTAAGCAAGGTCTCAGTTTCGATTCTTG BLAST |
Tissue | flowers |
Gene name | LI_gene_30514; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_242149
Blastp | Sulfite oxidase from Arabidopsis with 69.7% of identity |
---|---|
Blastx | Sulfite oxidase from Arabidopsis with 69.7% of identity |
Eggnog | The exact function is not known. Can catalyze the reduction of a variety of substrates like dimethyl sulfoxide, trimethylamine N-oxide, phenylmethyl sulfoxide and L-methionine sulfoxide. Cannot reduce cyclic N-oxides. Shows no activity as sulfite oxidase (By similarity)(COG2041) |
Kegg | Link to kegg annotations (AT3G01910) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019453296.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |