| Id Trinity | FTRINITY_DN53100_c3_g4_i2 |
|---|---|
| Name Transcript | Ll_transcript_224030 |
| Sequence | TTCCAATTCAATCACAATACCAAAAAAACATAGGGCACTGTGTTCCTTTCACTCTACCAAAAAAATTCTGAGTCCTTTCTTGGTTTTTAGAGAGAAGAAT TTTGCTATGTCTAGTGCATCATATCCACCACCTCCACCATTTTATAGACTCTACAAAAATTACTCACAGGATCCTAATTCTGCTCCTTCTCCTCCTCCTC CAATTGAAGGCTCTTATATTTGTTTTGGTGCTACTCATACTACTGATAATGTTTTACCAAGCTTGGAAGAACAAGGAGTGCGCCAACTCTATCCTAAGGG GCCTAATGTTGATTACAAAAAAGAGCTGAGATCCCTGGTTGGAGAATTGCTGCTACATCTTTTGGAGCTGGCCGATATTCTTATTCAGAGACCATCTCAG TTTGCAAGGAGAGTTGAGGAAATTTCAACTGTATTCAAAAACATGCATCACCTTTTGAATTCAATGCGTCCTCATCAGGCGAGGGCAACACTAATTCACA TCATGGAGCTTCAGATACAGCGCCGCAAAGAAGCAGTGGAGGATATAAAAAGGAGGAGAGGAGAATCACAAAAACTCCTTAATGAGTCTTTGGCAGC BLAST |
| Tissue | flowers |
| Gene name | LI_gene_30781; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_224030
| Blastp | Mediator of RNA polymerase II transcription subunit 7b from Arabidopsis with 71.17% of identity |
|---|---|
| Blastx | Mediator of RNA polymerase II transcription subunit 7a from Arabidopsis with 73.29% of identity |
| Eggnog | Component of the Mediator complex, a coactivator involved in the regulated transcription of nearly all RNA polymerase II-dependent genes. Mediator functions as a bridge to convey information from gene-specific regulatory proteins to the basal RNA polymerase II transcription machinery. Mediator is recruited to promoters by direct interactions with regulatory proteins and serves as a scaffold for the assembly of a functional preinitiation complex with RNA polymerase II and the general transcription factors(ENOG410ZFRU) |
| Kegg | Link to kegg annotations (AT5G03500) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019459141.1) |
| Pfam | MED7 protein (PF05983.10) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |