| Id Trinity | FTRINITY_DN53129_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_223728 |
| Sequence | GTTTGTTACATCTATTTAAACTTTCATAGGAATTACTGATTCAACATCTCTTTCACTGCAAATCCGTAGTAGTCATCAAAATGGTAAGAAGGTTCAGTGA TGAAACAAGAGATTACATCTCTTAGTGTAATGACTCCAATTACTTCCTCCTGTTCATTTACTGCATAAATCCTGTGAATAGATTGAGAAGCAAGATTGTG GATCACACTCTGCAGTGTTGAGTCAGGCTTGCATGTTATGGGTCTAATAACTTTTCCAGCTTCTTGGTTTAAGGAGGCAATTTTGCTCATGAAATCCATC ACAGTGAGCTTCCTAAAATTGGTGAAAAGCTCAGGCCTTAGCAGCAAGTGTCTGATGTCTCTTATGCTCAAGTTTCCAAAATTCTCTTCTTTGGACCCTA CTACAGTGACTCCTGGAATTTGTTAGCAATGCCAACAAGTGTCCTTAAGTGACGTGTGGCCTTTTGAAACATTTGTTATTTGTTTTCATTCATTTTATAC TTGTATAATATTGACATCAACAAAAACACAGATTAATGACCCCATGGTTTTCTTTAGAGTATAATGTTTTTTTACAAGGGAGCG BLAST |
| Tissue | flowers |
| Gene name | LI_gene_30981; |
| Additional information | - |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_223728
| Blastp | - |
|---|---|
| Blastx | SNF1-related protein kinase regulatory subunit gamma-1-like from Arabidopsis with 56.92% of identity |
| Eggnog | Catalyzes the conversion of inosine 5'-phosphate (IMP) to xanthosine 5'-phosphate (XMP), the first committed and rate- limiting step in the de novo synthesis of guanine nucleotides, and therefore plays an important role in the regulation of cell growth (By similarity)(COG0517) |
| Kegg | Link to kegg annotations (AT1G69800) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019454688.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |