Id Trinity | FTRINITY_DN53146_c2_g5_i4 |
---|---|
Name Transcript | Ll_transcript_222098 |
Sequence | CCAATACTCATCGCACTTTCTTCTTCCCTAACCTTCAATCATTCTTCTTCTTCTTCTTCTTCCCTAATCTGTAATCATCAGAATCTTCAATCCATCGTTG ATCATAACACCATGTCGTCTATGTTGCATAGAAGTTTCAAGCCCGTTAAGTGTAAAACTGCTTTGAAGCTTGCGGTATCACGCATGAAGATATTTAAGAA TAAGAAAGAAGGCGAAGTGAGGAAGCTCAGGAAGGAATTGGCTCAACTTCTTCAATCTGGCCAGGAATTAACTGCTAGAATAAGGGTATTTTCTTTTTCT TTGATTTCTTAGCTTATTCGTTTTGGAATTAATGTTTTCATGAAATTCATTTACTGTCTGTTTTCGGGTTGAGT BLAST |
Tissue | flowers |
Gene name | LI_gene_31086; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_222098
Blastp | IST1-like protein from Dictyostelium with 50% of identity |
---|---|
Blastx | IST1-like protein from Dictyostelium with 50% of identity |
Eggnog | positive regulation of collateral sprouting(ENOG410YG52) |
Kegg | Link to kegg annotations (DDB_G0289029) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019447983.1) |
Pfam | Regulator of Vps4 activity in the MVB pathway (PF03398.13) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |