| Id Trinity | FTRINITY_DN53146_c2_g5_i4 |
|---|---|
| Name Transcript | Ll_transcript_222098 |
| Sequence | CCAATACTCATCGCACTTTCTTCTTCCCTAACCTTCAATCATTCTTCTTCTTCTTCTTCTTCCCTAATCTGTAATCATCAGAATCTTCAATCCATCGTTG ATCATAACACCATGTCGTCTATGTTGCATAGAAGTTTCAAGCCCGTTAAGTGTAAAACTGCTTTGAAGCTTGCGGTATCACGCATGAAGATATTTAAGAA TAAGAAAGAAGGCGAAGTGAGGAAGCTCAGGAAGGAATTGGCTCAACTTCTTCAATCTGGCCAGGAATTAACTGCTAGAATAAGGGTATTTTCTTTTTCT TTGATTTCTTAGCTTATTCGTTTTGGAATTAATGTTTTCATGAAATTCATTTACTGTCTGTTTTCGGGTTGAGT BLAST |
| Tissue | flowers |
| Gene name | LI_gene_31086; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_222098
| Blastp | IST1-like protein from Dictyostelium with 50% of identity |
|---|---|
| Blastx | IST1-like protein from Dictyostelium with 50% of identity |
| Eggnog | positive regulation of collateral sprouting(ENOG410YG52) |
| Kegg | Link to kegg annotations (DDB_G0289029) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019447983.1) |
| Pfam | Regulator of Vps4 activity in the MVB pathway (PF03398.13) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |