Id Trinity | FTRINITY_DN53307_c0_g3_i8 |
---|---|
Name Transcript | Ll_transcript_246209 |
Sequence | AAGGTTAGTGAAACAAGGAACTGGGAAGACCACTCTAGCAATAGGTGAGGGTGCAAATGATGTTGGCATGATTCAGGAAGCAGACATCGGTGTTGGAATC AGCGGGGTTGAAGGCGGTGATGGCTAGTGACTTTTCTATTGCTCAATTTCGATTCCTGGAGCGGCTTCTGGTAGTCCATGGACACTGGTGTTACAAGAGA ATTGCGTTAATGATATGCTATTTCTTCTACAAAAATATAGCATTTGGCCTCACCATATTCTATTTTGAGGCTTATGCGGGCTTCTCTGGTCAATCAGTTT ATGAAGACTGGTACATGATATTGTTCAATGTTGTTCTTACATCATTGCCCGTCATTTCACTTGGAGTTTTTGAACAAGATGTTTCATCTGAAGTTTGCTT ACAGTTTCCTGCACTGTACCAGCAAGGACCCAA BLAST |
Tissue | flowers |
Gene name | LI_gene_32573; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_246209
Blastp | Phospholipid-transporting ATPase 6 from Arabidopsis with 87.5% of identity |
---|---|
Blastx | Probable phospholipid-transporting ATPase 5 from Arabidopsis with 88.89% of identity |
Eggnog | Phospholipid-transporting atpase(ENOG410XPYK) |
Kegg | Link to kegg annotations (AT1G54280) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_014501223.1) |
Pfam | Phospholipid-translocating P-type ATPase C-terminal (PF16212.4) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |