| Id Trinity | FTRINITY_DN53321_c6_g1_i14 |
|---|---|
| Name Transcript | Ll_transcript_245377 |
| Sequence | CAGATGGATCACCTGAGGTCATGTGAAGCCCCATCTCTACTAAAATTACAAAACAATTAGCTGGTCATGGGGATGAGTGCCTGTAATTCCAGCTACTTGG GAGGCTGAGGCAAGAGAATCACTTGAACCCAGGAGGCGGAGGTTGCAGTGAGCCAAGAATGCACCACTGCACTCCAGCCTGGCGACAGAGCAAGACTCTG TCTCAAAAAAAAAAAAAAGGCGGGGGGAGGCGC BLAST |
| Tissue | flowers |
| Gene name | LI_gene_32698; |
| Additional information | - |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_245377
| Blastp | - |
|---|---|
| Blastx | UPF0764 protein C16orf89 from Homo with 67.92% of identity |
| Eggnog | chromosome 16 open reading frame 89(ENOG4112ACS) |
| Kegg | Link to kegg annotations (146556) |
| CantataDB | - |
| Mirbase | hsa-mir-1273a (MI0006409) |
| Ncbi protein | - |
| Pfam | - |
| Rfam | Metazoa_SRP (RF00017) |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |