| Id Trinity | FTRINITY_DN53321_c6_g1_i6 |
|---|---|
| Name Transcript | Ll_transcript_245367 |
| Sequence | GTGAAGGAAAACATGGTGATTCAATCACTCCACACATCAAGCAGAAAAGAGTGTTGAACAGGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTT GGGAGGCCGAGGCGGGTGGATCATGAGGTCAGGAGATCGAGACCATCCTGGCTAACATGGTGAAACCCCATCTCTACCAAAAATACAAAAATTAGCTGGG C BLAST |
| Tissue | flowers |
| Gene name | LI_gene_32698; |
| Additional information | - |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_245367
| Blastp | - |
|---|---|
| Blastx | Olfactory receptor 1F12 from Homo with 91.67% of identity |
| Eggnog | - |
| Kegg | - |
| CantataDB | - |
| Mirbase | ppy-mir-619 (MI0015104) |
| Ncbi protein | Link to NCBI protein (XP_020210155.1) |
| Pfam | - |
| Rfam | Metazoa_SRP (RF00017) |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |