Id Trinity | FTRINITY_DN53345_c1_g1_i2 |
---|---|
Name Transcript | Ll_transcript_246555 |
Sequence | CAAAGGTTATATCCATCATTCCCCTCTTTTTATTCTTTCAATTTCGATTCAAATATTCTTCTCTAATCTCAACTTTTCTTTTTATTTGTTTTGATGCAGA GGCTCTTCGAGAGAGCAAACGAGAAATGAATAATGCTGCTAGAGGTATAGAGAGGGAAATAGGAGCATTACAACTTGAAGAAAAGAAGCTTGTTCTTGAG ATCAAGAAAACTGCTAAAACTGGAAACGAGGCTGCTACGAAAATTCTAGCCCGACAGTTGGTCCGGCTTAGGCAACAAATTGCTAATCTTCAAGGTAGTC GAGCTCAGATGAGGGGCATAACAACTCACACCCAGGCAATGTATGCTCAGTCTTCTGTTGCCGTTGGCATGAAAGGCGCCACTAAGGCAATGGCAGCTAT GAATAAGCAAATGGCACCTGCAAAGCAACTCAAAATTATGCAGGAGTTTCAG BLAST |
Tissue | flowers |
Gene name | LI_gene_32970; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_246555
Blastp | Vacuolar protein sorting-associated protein 2 homolog 3 from Arabidopsis with 80.51% of identity |
---|---|
Blastx | Vacuolar protein sorting-associated protein 2 homolog 3 from Arabidopsis with 80.51% of identity |
Eggnog | Charged multivesicular body protein(COG5491) |
Kegg | Link to kegg annotations (AT1G03950) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019426723.1) |
Pfam | Snf7 (PF03357.20) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |