Ll_transcript_180884

• Id Trinity: FTRINITY_DN53530_c1_g2_i3
• Name Transcript: Ll_transcript_180884
• Sequence: TGAATATTTACCAAGAGGGAGCTTAGAGAATCAACTTTTTAGAAGATACTCAGCATCATTACCTTGGTCAACAAGAATGAAAATAGCTGTTGGAGCTGCA AAGGGTCTAGCCTTCTTACATGAGGCACAGAAACCAGTCATCTATAGAGATTTTAAAGCTTCAAACATATTGTTAGACTCAAATTATGGTGCAAAACTTT CAGATTTTGGGTTGGCAAAAGATGGCCCTGAAGGAGATGACACCCATGTTTCAACTAGAGTCATGGGCACCCATGGCTATGCTGCCCCAGAATATGTCAT GACAG
• Tissue: flowers
• Gene name: LI_gene_34512;
• Additional information: details;

Expression of Ll_transcript_180884

FPKM

• FPAB: 15.7
• FPNAB: 4.4
• LF1: 4.8
• LF2: 2.4
• LF3: 1.6
• LF4: 3.9
• UF1: 2.2
• UF2: 2.3
• UF3: 0.9
• UF4: 1.6

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_180884

• Blastp: Serine/threonine-protein kinase RIPK from Arabidopsis with 89.11% of identity
• Blastx: Serine/threonine-protein kinase RIPK from Arabidopsis with 89.11% of identity
• Eggnog: Serine Threonine protein kinase(COG0515)
• Kegg: Link to kegg annotations (AT2G05940)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_019455203.1)
• Pfam: Protein kinase domain (PF00069.24)
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;
  Links to GO: General; Genes and gene products; Annotations; Ontology;