Id Trinity | FTRINITY_DN53542_c9_g1_i1 |
---|---|
Name Transcript | Ll_transcript_182269 |
Sequence | GGAGGATCGACAATTCAACGAGTAGGCAAGTGACGTTCTCGAAGCGAAGGAATGGTTTGCTGAAGAAGGCGAAGGAACTCGCGATTTTGTGCGATGCTGA GGTTGGAGTTGTTATCTTCTCTAGCACCAGCAAACTCTACGATTTCTCCAGCACCAGCATGAAATCAGTAATCGAGCGATACAACGAAACAAAAGAGGGG CATCATCAACTTGGGAGTTCATCCTCAGAAATTAAGTATTGGCAAAAGGAGGCAGCAATGTTAAGGCAACAATTGCAAAACTTGCAAGAAAGTCACAGGC AAATCATGGGAG BLAST |
Tissue | flowers |
Gene name | LI_gene_34634; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_182269
Blastp | MADS-box transcription factor 23 from Oryza sativa with 74.76% of identity |
---|---|
Blastx | MADS-box transcription factor 23 from Oryza sativa with 74.76% of identity |
Eggnog | Transcription factor(COG5068) |
Kegg | - |
CantataDB | Link to cantataDB annotations (CNT0001842) |
Mirbase | osa-MIR444f (MI0006978) |
Ncbi protein | Link to NCBI protein (XP_020963290.1) |
Pfam | SRF-type transcription factor (DNA-binding and dimerisation domain) (PF00319.17) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |