Ll_transcript_182375

• Id Trinity: FTRINITY_DN53544_c1_g2_i3
• Name Transcript: Ll_transcript_182375
• Sequence: AAAAAAGTCCATCTAGCACTTTTGGGAATGTATGAAAGGACTGAGCAGCATGATTTAGCTGATGAACTCTGCAATAAAATGACAAAGAAGTTCAAGCATT CGTGCAAAGTATTATGCGAATTTTAAAATATAAATCCTATTTTTTGTGTTCTTCAAAGTCAATGTATATGTAACTTACTCTACTGGATTTTAGGTATGGT TGAGGTCTGTACAAAGACTTTTGAAGCAAAGGCGAG
• Tissue: flowers
• Gene name: LI_gene_34643;
• Additional information: -

Expression of Ll_transcript_182375

FPKM

• FPAB: 0
• FPNAB: 0.5
• LF1: 0
• LF2: 0
• LF3: 0
• LF4: 0
• UF1: 0
• UF2: 0
• UF3: 0
• UF4: 0.4

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_182375

• Blastp: -
• Blastx: rRNA biogenesis protein RRP5 from Arabidopsis with 70.27% of identity
• Eggnog: thus facilitating recognition of the initiation point. It is needed to translate mRNA with a short Shine-Dalgarno (SD) purine-rich sequence (By similarity)(COG0539)
• Kegg: Link to kegg annotations (AT3G11964)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_019434480.1)
• Pfam: -
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;