Id Trinity | FTRINITY_DN53591_c2_g1_i16 |
---|---|
Name Transcript | Ll_transcript_182113 |
Sequence | GGAAGGGGTAGGGTACAACTGAAGAGGATAGAAAACAAGATCAACAGGCAAGTAACTTTCTCCAAAAGGAGAGCTGGGTTACTCAAGAAAGCTCATGAGA TCTCAGTTCTCTGTGATGCTGAGGTTGCTCTGATTGTCTTCTCCCACAAAGGAAAGCTCTTTGAATATGCCACTGATTCATGCATGGAGAAGATACTGGA ACGCCATGAAAGGTATGCCTATGCAGAGAGACAGCTGGTGGCAAATGATTCTGAGACTCAGGTTCGTGTCATTAGATTCATATATAGTTTATATATACAT AAATAGGGGTCATATGTTCCACTTTTAATATCTCGTTATGTGCCAAACCAATTGAAAATTGACATATATTTAAAAAGAAAAATTAAAAAAGCAAAAGACA AGTTTTTTATATTATTTāBLAST |
Tissue | flowers |
Gene name | LI_gene_35060; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_182113
Blastp | Floral homeotic protein APETALA 1 A from Brassica with 86.36% of identity |
---|---|
Blastx | Floral homeotic protein APETALA 1 A from Brassica with 88.37% of identity |
Eggnog | - |
Kegg | - |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019443748.1) |
Pfam | SRF-type transcription factor (DNA-binding and dimerisation domain) (PF00319.17) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |