| Id Trinity | FTRINITY_DN53626_c0_g1_i4 |
|---|---|
| Name Transcript | Ll_transcript_264649 |
| Sequence | AAAGACGGTAAAATCCGTTCCCTCGAACAGATCTACCTCCACTCACTCCCAATCAAGGAACACCAAATCATCGACACCCTTGTGGGACCCTCCCTCAAAG ACGAAGTCATGAAAATCATGCCGGTTCAGAAACAAACCCGGGCCGGTCAGCGAACCCGGTTCAAGGCCTTTGTTGTTGTCGGTGACAATAACGGCCACGT TGGGCTCGGTGTTAAGTGCAGCAAGGAGGTTGCCACCGCGATTCGCGGCGCGATAATTCTCGCGAAGCTTTCTGTTATTCCAGTGAGGAGAGGGTATTGG GGAAATAAGATTGGGAAGCCTCACACTGTTCCGTGTAAGGTTACTGGGAAGTGTGGTTCTGTTACTGTGAGGATGGTTCCTGCACCTCGTGGTTCGGGGA TTGTTGCTGCTAGGGTTCCTAAGAAGGTGCTTCAATTTGCTGGGATTGATGATGT BLAST |
| Tissue | flowers |
| Gene name | LI_gene_35388; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_264649
| Blastp | 40S ribosomal protein S2-4 from Arabidopsis with 92.72% of identity |
|---|---|
| Blastx | 40S ribosomal protein S2-4 from Arabidopsis with 92.72% of identity |
| Eggnog | Located at the back of the 30S subunit body where it stabilizes the conformation of the head with respect to the body (By similarity)(COG0098) |
| Kegg | Link to kegg annotations (AT3G57490) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019424308.1) |
| Pfam | Ribosomal protein S5, N-terminal domain (PF00333.19) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |