Id Trinity | FTRINITY_DN53626_c0_g1_i4 |
---|---|
Name Transcript | Ll_transcript_264649 |
Sequence | AAAGACGGTAAAATCCGTTCCCTCGAACAGATCTACCTCCACTCACTCCCAATCAAGGAACACCAAATCATCGACACCCTTGTGGGACCCTCCCTCAAAG ACGAAGTCATGAAAATCATGCCGGTTCAGAAACAAACCCGGGCCGGTCAGCGAACCCGGTTCAAGGCCTTTGTTGTTGTCGGTGACAATAACGGCCACGT TGGGCTCGGTGTTAAGTGCAGCAAGGAGGTTGCCACCGCGATTCGCGGCGCGATAATTCTCGCGAAGCTTTCTGTTATTCCAGTGAGGAGAGGGTATTGG GGAAATAAGATTGGGAAGCCTCACACTGTTCCGTGTAAGGTTACTGGGAAGTGTGGTTCTGTTACTGTGAGGATGGTTCCTGCACCTCGTGGTTCGGGGA TTGTTGCTGCTAGGGTTCCTAAGAAGGTGCTTCAATTTGCTGGGATTGATGATGT BLAST |
Tissue | flowers |
Gene name | LI_gene_35388; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_264649
Blastp | 40S ribosomal protein S2-4 from Arabidopsis with 92.72% of identity |
---|---|
Blastx | 40S ribosomal protein S2-4 from Arabidopsis with 92.72% of identity |
Eggnog | Located at the back of the 30S subunit body where it stabilizes the conformation of the head with respect to the body (By similarity)(COG0098) |
Kegg | Link to kegg annotations (AT3G57490) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019424308.1) |
Pfam | Ribosomal protein S5, N-terminal domain (PF00333.19) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |