Id Trinity | FTRINITY_DN53629_c4_g5_i3 |
---|---|
Name Transcript | Ll_transcript_263350 |
Sequence | AGCTAAGAGAAAGAGAAACCTTCCAGGCAACCCAGACCCAGATTCTGAAGTTATAGCTTTATCTCCAAAGACATTAATGGCAACTAATAGGTTCATATGT GAGATCTGTAACAAGGGATTCCAAAGAGACCAGAATCTTCAACTCCATAGAAGAGGGCATAATTTACCATGGAAGCTGAAGCAAAGAACAAACAAAGAAG TAATAAGGAAGAAGGTGTATGTGTGTCCAGAAGAAAGTTGTGTGCACCATGACCCATCAAGGGCATTAGGGGACTTAACTGGGATAAAAAAGCACTTCTG CAGAAAGCATGGTGAGAAGAAGTGGAAATGTGAAAAGTGCTCCAAGAAATATGCTGT BLAST |
Tissue | flowers |
Gene name | LI_gene_35419; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_263350
Blastp | Protein indeterminate-domain 11 from Arabidopsis with 93.16% of identity |
---|---|
Blastx | Protein indeterminate-domain 11 from Arabidopsis with 93.2% of identity |
Eggnog | - |
Kegg | Link to kegg annotations (AT3G13810) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019435341.1) |
Pfam | C2H2-type zinc finger (PF13912.5) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |