| Id Trinity | FTRINITY_DN53714_c5_g2_i3 |
|---|---|
| Name Transcript | Ll_transcript_124272 |
| Sequence | ATTTGGTTTATTCTATGCAAATAGCTTTGTCAAGAACCTTCTGCATTTATGAGGAGGTTGAGCAAATGCGCAATGCTGGACTTATCAAAGGAGGTTCTCT AGAAAATGCCATCGTTTGCAGGTAAATATTATAGCCAGCTATATAAAAGCTAGTGAACAAATTTGATAGATTATGTTACTGAAGCAGTAAACCTTATGAA G BLAST |
| Tissue | flowers |
| Gene name | LI_gene_36173; |
| Additional information | - |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_124272
| Blastp | - |
|---|---|
| Blastx | Probable UDP-3-O-acyl-N-acetylglucosamine deacetylase 5, mitochondrial from Arabidopsis with 75.68% of identity |
| Eggnog | involved in the biosynthesis of lipid A, a phosphorylated glycolipid that anchors the lipopolysaccharide to the outer membrane of the cell (By similarity)(COG0774) |
| Kegg | Link to kegg annotations (AT1G24793) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_013466579.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |