Ll_transcript_25000

• Id Trinity: FTRINITY_DN53825_c5_g3_i1
• Name Transcript: Ll_transcript_25000
• Sequence: CTGCTCTAGAAACTTCGTAAGTCGCGAGTGCTTCGCAGCCCATTGCTCGGTCAATTTCTGCTCCTTGGTTTCTGCATCTCTTCTCAACACCGCCAACTGT TCCCTGTATTCCATTTCAATTCTGTCCAAGGCAGCCGCCTGCTCGTCCCGAAGTGCTTTAATCTTCGCTTCTATTTCTTCCATCTTCTCCCTCCTCCGAC TCGCCTTCTCTGACTCCAGCTGCAACTCCACCCGGCTTAACCGCCATGTTGTTT
• Tissue: flowers
• Gene name: LI_gene_37188;
• Additional information: -

Expression of Ll_transcript_25000

FPKM

• FPAB: 0.4
• FPNAB: 2.5
• LF1: 0.4
• LF2: 0.4
• LF3: 0
• LF4: 0.4
• UF1: 2.8
• UF2: 0.8
• UF3: 1.4
• UF4: 0.4

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_25000

• Blastp: -
• Blastx: Protein rough sheath 2 homolog from Oryza sativa with 67.86% of identity
• Eggnog: Myblike DNAbinding domain containing protein(COG5147)
• Kegg: Link to kegg annotations (4352588)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_019460680.1)
• Pfam: -
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;