Ll_transcript_24121

• Id Trinity: FTRINITY_DN53834_c0_g3_i1
• Name Transcript: Ll_transcript_24121
• Sequence: CGAAATACAGAAAATACAAGGATAAGTATGATTGGTAGTATAAAAAAAAATATTTTTATATAAAAAAAAAAAAGTTGTAGTGTTTAGGTAATTTAGGTGT GTCAGAAGTAAGGTGAAGTTTTGATTTTGAAGTTTGAATCAGAGATATGGCTTCAGGTTGGGGAATCAATGGTAACAAAGGTCGTTGCTACGATTTCTGG ATTGATTTCAGTGAATGCATGTCTCGTTGCAGAGAACCCAAAGAT
• Tissue: flowers
• Gene name: LI_gene_37269;
• Additional information: -

Expression of Ll_transcript_24121

FPKM

• FPAB: 0.5
• FPNAB: 6.1
• LF1: 5.6
• LF2: 2.2
• LF3: 5.8
• LF4: 7
• UF1: 5.8
• UF2: 4.2
• UF3: 4
• UF4: 8.1

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_24121

• Blastp: -
• Blastx: NADH dehydrogenase [ubiquinone] iron-sulfur protein 5-B from Arabidopsis with 90.91% of identity
• Eggnog: NADH dehydrogenase ubiquinone iron-sulfur protein(ENOG410Y2MY)
• Kegg: Link to kegg annotations (AT3G62790)
• CantataDB: Link to cantataDB annotations (CNT0001968)
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_016196954.1)
• Pfam: -
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;