Id Trinity | FTRINITY_DN53852_c0_g3_i4 |
---|---|
Name Transcript | Ll_transcript_25600 |
Sequence | CTCTGTGCTTTATGGCTGGTTCTGAGTTGATTTAGCTTTGAAGAATGGAGGGTGACACATCCTCTGGTCTTGGAAATGGTACAGAGATTGATAGCAAGAT ATCACAGACATTTCATAACAGCTTTGTTCAAGTCCAGAATATATTGGGCCAGAATAGGATGCTCGTTAACGAGACAAATTGGAATTATGAGTCTAAGGTT CCAGACAATCTCAGCACGAATGTTGGCCTTATTAGAGAGCTCAACAATACCATTAGAAGAGTATTTGACCTTGTCTCTGTCGATTCACTCATTGAGGAAG TTCCTATAGTTGAGCTCCTCAATGAATATGTCCAGAGTTGTGACATTGTTACCTTCAATACAATACAACTCATTCAGTAGAGATGAAGATCATGCTATTC GGAAAGTTGCAAGTTTTTGACATTATGTTCTATGCATACT BLAST |
Tissue | flowers |
Gene name | LI_gene_37403; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_25600
Blastp | Protein ELF4-LIKE 3 from Arabidopsis with 66.23% of identity |
---|---|
Blastx | Protein ELF4-LIKE 3 from Arabidopsis with 66.23% of identity |
Eggnog | early flowering(ENOG410Y56Z) |
Kegg | Link to kegg annotations (AT2G06255) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_020227478.1) |
Pfam | Protein of unknown function (DUF1313) (PF07011.10) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |