Id Trinity | FTRINITY_DN53867_c0_g2_i1 |
---|---|
Name Transcript | Ll_transcript_24778 |
Sequence | CTCGTTGATCATTGGGAGGAATTGACTCGCAGGTTGGAATAGCACTGATTTTCCATTATTACCTTTCTTAGGACTTCGGTTTTTTTGGGGCCCCTTTATG TCAATTCCATGGCTTCCTGCGTAATACACTTCTGCCAATCTTACAAAATTATATACCTTGTCTCTGCACCTTCCGGTCACGATGGCCGTAGGAAAATGTC TTGCTATTTCCTTTAGAGTCCCTTTCATCTTT BLAST |
Tissue | flowers |
Gene name | LI_gene_37522; |
Additional information | - |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_24778
Blastp | - |
---|---|
Blastx | Probable trehalose-phosphate phosphatase 7 from Oryza sativa with 61.04% of identity |
Eggnog | trehalose biosynthetic process(COG1877) |
Kegg | Link to kegg annotations (4346885) |
CantataDB | Link to cantataDB annotations (CNT0002182) |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019416047.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |