Ll_transcript_24778

• Id Trinity: FTRINITY_DN53867_c0_g2_i1
• Name Transcript: Ll_transcript_24778
• Sequence: CTCGTTGATCATTGGGAGGAATTGACTCGCAGGTTGGAATAGCACTGATTTTCCATTATTACCTTTCTTAGGACTTCGGTTTTTTTGGGGCCCCTTTATG TCAATTCCATGGCTTCCTGCGTAATACACTTCTGCCAATCTTACAAAATTATATACCTTGTCTCTGCACCTTCCGGTCACGATGGCCGTAGGAAAATGTC TTGCTATTTCCTTTAGAGTCCCTTTCATCTTT
• Tissue: flowers
• Gene name: LI_gene_37522;
• Additional information: -

Expression of Ll_transcript_24778

FPKM

• FPAB: 0
• FPNAB: 0.6
• LF1: 0
• LF2: 0.5
• LF3: 0
• LF4: 0
• UF1: 0.5
• UF2: 0.6
• UF3: 1.4
• UF4: 0

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_24778

• Blastp: -
• Blastx: Probable trehalose-phosphate phosphatase 7 from Oryza sativa with 61.04% of identity
• Eggnog: trehalose biosynthetic process(COG1877)
• Kegg: Link to kegg annotations (4346885)
• CantataDB: Link to cantataDB annotations (CNT0002182)
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_019416047.1)
• Pfam: -
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;