| Id Trinity | FTRINITY_DN53966_c0_g1_i15 |
|---|---|
| Name Transcript | Ll_transcript_89069 |
| Sequence | AGAGGTAATTTTGACACTTTGTAGGATTATGATTCATCAAATGTTAACTTATTTATTCTATTTTAGGTGTTTTAATGTTATACATAAGCATTGAACTCAC AAGCTTTTTTTTATCCATACACTTGAAGGTCAAACTTCAACGAGAATTTATTAAGCTCTCTCCGATTTCCGTTGCGATCATCCCTCACAGGTCCCCGGAT GGGAAGGTAACAAAAACTGGCTATGTGAAATTGTCAGCCTTCTCTCAG BLAST |
| Tissue | flowers |
| Gene name | LI_gene_38502; |
| Additional information | - |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_89069
| Blastp | - |
|---|---|
| Blastx | Carboxyl-terminal-processing peptidase 3, chloroplastic from Arabidopsis with 73.17% of identity |
| Eggnog | protease(COG0793) |
| Kegg | Link to kegg annotations (AT3G57680) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019459724.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |