| Id Trinity | FTRINITY_DN53993_c0_g1_i4 |
|---|---|
| Name Transcript | Ll_transcript_89906 |
| Sequence | ATTTTTGAATAAATAGCTTTTCTTCTCAGTGATTGTTTTCGGTTTGATTGCACTTTTTTCTAACATTTATGTTATGGCCTGTCATATTGTGCTATACCAG GGTGATACCAAGGGTTCGACCAAGGGAGGAGATGTATCTTCCAGGAAAGATGTTCACCCAAGCCCTAATGCTCAGTTTGCTCATCAAGGTTCTTTCTCAC AAGGTCATGGTGTTGATTACACAAATTCTCAGGCTCAACATATGATGCTTCCTTATCAAGACCAGGAATAGATATTAATCTTGCTTCAGTGTTTTCATGC ATCATTTCAATGCCTTGGAGCTATAGTATGTGCCCTTGGCATATTTAAAGCATTTTATGTCATGTGAATATGGACTTAAGAGATGTTGGTTCTTGTAACG GGATATTATTTGTTAATCATTAAGACCTGCATATTATCTTCACGTGTCTTTGCAGAATGAACATTTTATGTTATTGGTTCCAAACATAAACTGGCATGTT CTTTTCCTTATTCCTACTGATGGCATCACGCTTTTTTGTTTAGCAGTAATCTCTTCATTTTGTTTGCAAGATACAGTATTTATTCTTACGTATGCCACAG AAAATTCCCâBLAST |
| Tissue | flowers |
| Gene name | LI_gene_38743; |
| Additional information | - |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_89906
| Blastp | - |
|---|---|
| Blastx | Nuclear transcription factor Y subunit B-10 from Arabidopsis with 38.27% of identity |
| Eggnog | Core component of nucleosome. Nucleosomes wrap and compact DNA into chromatin, limiting DNA accessibility to the cellular machineries which require DNA as a template. Histones thereby play a central role in transcription regulation, DNA repair, DNA replication and chromosomal stability. DNA accessibility is regulated via a complex set of post-translational modifications of histones, also called histone code, and nucleosome remodeling(COG2036) |
| Kegg | Link to kegg annotations (AT3G53340) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019443047.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |