| Id Trinity | FTRINITY_DN54025_c1_g8_i1 |
|---|---|
| Name Transcript | Ll_transcript_141049 |
| Sequence | CTTGGAGTTCGGATTGAAATTCATTTAACCTCCTCAGGGACAAGTCAGACTCGTCGACTTCAGGTGAAGCATCACTAAGGCTCAAATTCCCGGCTATCTC TCCACATATTTTTTGGATCTGTGACTGTACATCTGAGAACTCCTTGATTCTTTCTTCCTTTTGTTGCCATAATTGTTCAAGTATTGGTGCTATAGCTGCA AGCTGCTCCTTAATAGTTCCAGAAGTGTTTTCAGGAATTCCAGCAAAGTTCTTCTCTCCAAGAGCTGATAGAAGACTAGAAAGCTCAACATTGGCATCAG ACAAGGCTTGAAG BLAST |
| Tissue | flowers |
| Gene name | LI_gene_39073; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_141049
| Blastp | 65-kDa microtubule-associated protein 1 from Arabidopsis with 73.08% of identity |
|---|---|
| Blastx | 65-kDa microtubule-associated protein 1 from Arabidopsis with 73.08% of identity |
| Eggnog | protein regulator of cytokinesis(ENOG410YZBK) |
| Kegg | Link to kegg annotations (AT5G55230) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019435642.1) |
| Pfam | Microtubule associated protein (MAP65/ASE1 family) (PF03999.11) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |