Id Trinity | FTRINITY_DN54118_c0_g2_i2 |
---|---|
Name Transcript | Ll_transcript_44646 |
Sequence | TATCCCAATGAGCCATTTATCGAGCCGTACGAGAAGAAAACTTCTTATACAGTTATAGGGGTGTGTATTATTCATCTATATCTATCCCAATGAGCCATTT ATCGAATCGTTGCAATTGATGTTCGATCCCGAAGAGAGGGAAGAGATCTTCGGAAAAAGGGGGTTTTTATGATCCACTAAAGAATAAAATCTATTTAAAT ATTCCTGTTATTCTTTATTTCCTTGAACAAGGCGCTCAACCTACAGGAGCCGTATGAGGTGAAAATCTCATGTACGGTTCTGT BLAST |
Tissue | flowers |
Gene name | LI_gene_39897; |
Additional information | - |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_44646
Blastp | - |
---|---|
Blastx | 30S ribosomal protein S16, chloroplastic from Soja with 70.73% of identity |
Eggnog | - |
Kegg | Link to kegg annotations (3989305) |
CantataDB | Link to cantataDB annotations (CNT0002248) |
Mirbase | - |
Ncbi protein | Link to NCBI protein (YP_008963609.1) |
Pfam | - |
Rfam | Intron_gpII (RF00029) |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |