Id Trinity | FTRINITY_DN54125_c2_g1_i6 |
---|---|
Name Transcript | Ll_transcript_44716 |
Sequence | GGAAAAGGGACTCTGAGTAGGTATAAGAGTGAGAGTTCCATTGCTGCAACTGAAGATGAAGATGATGGTGATGATAGAAAAATTGAATTGGGTCCTCAGT GCACATTGAAGGAACAGCTTGAAAAGGATAAGGATGATGAGAGCTTGAGGAGGTGGAAGGAGCAGCTTCTTGGAAGTGTTGACATTAATGCTGTTGGAGA AACTCTGGAGCCAGAAGTGAAGATCTTGAGCCTTGCAATCAAATCTGCTGGTAGAGATGATATTTTCCTTCCGATACCGGAGGGAGGAAATCCGAAGGGC CTGTGGTTTACTTTGAAAGAAGGTAGTCGTTACAGTCTGATGTTCACTTTCCAGGTGAGCAACAACATTGTTTCCGGTCTCAAATACAGTCACAATGTGT GGAAAACTGGTATCAAGGTTGATAGCAGTAAAGAAATGATCGGAACATTCAGCCCGCAAGCAGAGCCTTACACTCATGAGATGCCTGAAGAGGTAACACC ATCTGGGATGTTTGCTAGAGGAACATATTCAGCTAGAAGTAAGTTTGTTGATGATGACAACAAG BLAST |
Tissue | flowers |
Gene name | LI_gene_39969; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_44716
Blastp | Rho GDP-dissociation inhibitor 1 from Arabidopsis with 73.37% of identity |
---|---|
Blastx | Rho GDP-dissociation inhibitor 1 from Arabidopsis with 73.37% of identity |
Eggnog | Rho GDP dissociation inhibitor (GDI)(ENOG4111K44) |
Kegg | Link to kegg annotations (AT3G07880) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019424810.1) |
Pfam | RHO protein GDP dissociation inhibitor (PF02115.16) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |