Id Trinity | FTRINITY_DN54160_c0_g2_i6 |
---|---|
Name Transcript | Ll_transcript_44027 |
Sequence | GCTCAGTTGTGTTTGCTGGAATAACTACATCAAGAACTATCTTGCCTCCACAGACTATGGTGGTGTAGTTAAGGTTTGTATCTCTTGCGTATGATCCCAA TCTGTACCATTGTAGAATTCTTTGTATTATCACTTGAAAGAGACAAATTGTTAATGTGAGTTGCTTGAGTGATTTGTATGCAAATGTCCAGTCCTGCAAG GATATATAAAACTAACCCAGACCGTAGATAACATGTCCATGG BLAST |
Tissue | flowers |
Gene name | LI_gene_40260; |
Additional information | - |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_44027
Blastp | - |
---|---|
Blastx | Protein SUPPRESSOR OF PHYA-105 1 from Arabidopsis with 84% of identity |
Eggnog | eukaryotic translation initiation factor 2alpha kinase(ENOG410XS0B) |
Kegg | Link to kegg annotations (AT2G46340) |
CantataDB | Link to cantataDB annotations (CNT0001073) |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_004511527.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |