Ll_transcript_43816

• Id Trinity: FTRINITY_DN54177_c1_g2_i1
• Name Transcript: Ll_transcript_43816
• Sequence: AAAGCTTCACAACCGAGGTATTATTTTGCATCACCAGGCCCACCAAAGGGGTATCCCAGAGAAGAGCCACCGCCAGGTGCAGCATGCACCTTGGTCGAAG GTCGGTCCGTTATGAAGTTGCCGGTGTTCAGACCATCTATAGAACTACTGTTGATACCAGCAGGCTTATTCGGGTCAATTGTTTTTGGAGCAGCAACTGG TTTTGAAGGAGGTGCATTATTTACAGTCT
• Tissue: flowers
• Gene name: LI_gene_40387;
• Additional information: -

Expression of Ll_transcript_43816

FPKM

• FPAB: 0
• FPNAB: 0.6
• LF1: 6.5
• LF2: 0
• LF3: 0.7
• LF4: 0
• UF1: 10.1
• UF2: 3
• UF3: 4.5
• UF4: 0

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_43816

• Blastp: -
• Blastx: Protein SPIRAL1-like 1 from Arabidopsis with 57.41% of identity
• Eggnog: in maintaining the cortical microtubules organization essential for anisotropic cell growth(ENOG410XU77)
• Kegg: Link to kegg annotations (AT1G26355)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_019428788.1)
• Pfam: -
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;