Id Trinity | FTRINITY_DN54184_c0_g3_i9 |
---|---|
Name Transcript | Ll_transcript_43370 |
Sequence | ATGAAACCTAGGTTTTGCCGTGTCTATAAGAACCCTTGAAATTGATCCATGTGAATGGTGCTGCCGCTGAAGCTTGGATCGTGTGTGTTTTTTGCATCTA TCAATCAACAACCAAAATGGTTAAGGGTAGACAAGGAGAGCGTGTCAGACTTTATGTCAGGGGAACAATCCTTGGATACAAGAGGTCCAAGTCAAATCAA TACCCTAACACTTCTCTGCTCCAGATTGAGGGAGTAAACACCAAGGAAGAGGTTACATGGTATGCTGGGAAGCGCCTGGCGTACATTTACAAAGCCAAGG TAAAGACAAATGGAAGTCACTATCGCTGTATTTGGGGTAGGGTTACCAGGTCTCATGGTAACAGTGGTATTGTTCGTGCAAAGTTCAAGTCAAACCTTCC ACCCAAATCAATGG BLAST |
Tissue | flowers |
Gene name | LI_gene_40461; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_43370
Blastp | 60S ribosomal protein L35a-3 from Arabidopsis with 88.89% of identity |
---|---|
Blastx | 60S ribosomal protein L35a-3 from Arabidopsis with 88.89% of identity |
Eggnog | Ribosomal protein(COG2451) |
Kegg | Link to kegg annotations (AT1G74270) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019460881.1) |
Pfam | Ribosomal protein L35Ae (PF01247.17) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |