| Id Trinity | FTRINITY_DN54199_c6_g1_i7 |
|---|---|
| Name Transcript | Ll_transcript_42813 |
| Sequence | AATTGTTCCACCTTCCTCTTCACAAAAACCTAAGCCTCTAAGCTTACACTTTGATCATGGCCAAACTTGCGGTTGACAATGACTATCTCAAAGAAATTGA TAAGGCACGACGTCACCTTCGAGCTCTTATCTCTACAAGAAACTGTGCTCCTCTCATGCTTCGATTAGCGTGGCACGATGCTGGTACTTATGATGATAAA ACTAGAACAGGAGGTCCCAACGGTTCTATCAGGAATACACAAGAGTTGAATCACAGTGCTAACAAGGGTTTACAAAAAGCAGTTGAATTCTGTGGTGACC ATTCTTCTTCATTTGTCTGTGTGTGTTTATATTTGTTTTTCTCCCTGCCCAACTCCTAAATTTTTCTGGGTTATTTTCGAGAACAGAAGAAGTGAAG BLAST |
| Tissue | flowers |
| Gene name | LI_gene_40583; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_42813
| Blastp | L-ascorbate peroxidase 5, peroxisomal from Arabidopsis with 74.32% of identity |
|---|---|
| Blastx | L-ascorbate peroxidase 5, peroxisomal from Arabidopsis with 74.32% of identity |
| Eggnog | Bifunctional enzyme with both catalase and broad- spectrum peroxidase activity (By similarity)(COG0376) |
| Kegg | Link to kegg annotations (AT4G35970) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019444830.1) |
| Pfam | Peroxidase (PF00141.22) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |