Id Trinity | FTRINITY_DN54294_c5_g1_i6 |
---|---|
Name Transcript | Ll_transcript_274325 |
Sequence | CTCATAACTCTCTGTTAATCATGACTTTAAAAATGACAAAGTTGTTTCAAATTTTCTTCCTCTGTATTATTTCCCTCACATGTCTCTCATTTGCTACTAA TGAGTACTCCATTTTGCACCATAATCATCTGAACAAATTTTCTTCCTCAGAGGAAGGAGTTTTCCAACTATTCAAGCTGTGGCAGAAGGAACATGGGAGA CAATATGGAAACCCAGAAGAGGAATCAAGCAGATTGGAGATTTTCCAAAAGAACTTGTTGTATATCAATGAGCATAACTCACAGAGAAAGTCACAGTTGC AGCATCATTTGGGTTTGAACAAATTTGCTG BLAST |
Tissue | flowers |
Gene name | LI_gene_41398; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_274325
Blastp | P34 probable thiol protease from Soja with 55.22% of identity |
---|---|
Blastx | P34 probable thiol protease from Soja with 55.22% of identity |
Eggnog | cathepsin(COG4870) |
Kegg | Link to kegg annotations (548062) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019440324.1) |
Pfam | Cathepsin propeptide inhibitor domain (I29) (PF08246.11) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |