Ll_transcript_196879

• Id Trinity: FTRINITY_DN54332_c4_g1_i2
• Name Transcript: Ll_transcript_196879
• Sequence: ACCTGAATCTTGGAGGCTTGCTTGTCAAACTATTGTTGGTAACAAGGAGAACAGTGGCAAGGTTGTTGTTCAAAGGATTCCTCAGTGGAAGAAGTGATAG ACAAAGACAAAGCAAAAACCAAGCACAATCCCTTGATGTAACTTCTGTATTTAACAAAATGTATGCATTTAACAAGTGCAATCTCATATATATATATATA TATATATATATATATATATATATA
• Tissue: flowers
• Gene name: LI_gene_41707;
• Additional information: -

Expression of Ll_transcript_196879

FPKM

• FPAB: 14.3
• FPNAB: 7.2
• LF1: 11.1
• LF2: 12
• LF3: 3.1
• LF4: 9.1
• UF1: 13.3
• UF2: 14.6
• UF3: 20.1
• UF4: 15.1

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_196879

• Blastp: -
• Blastx: Photosynthetic NDH subunit of subcomplex B 3, chloroplastic from Arabidopsis with 58.62% of identity
• Eggnog: Ferredoxin(COG0633)
• Kegg: Link to kegg annotations (AT3G16250)
• CantataDB: Link to cantataDB annotations (CNT0001788)
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_020224392.1)
• Pfam: -
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;